Riveting facts about DNA Mapping

 

What is a genome map or DNA map?

A genome mapping or DNA mapping involves landmarks that usually are short sequences. DNA map and sequence are completely different. A map includes the series of landmarks while a sequence describes that DNA base in a clear fashion. In a nutshell, a genome map only shows the start, connecting and end landmarks that actually connect the sequence while a sequence shows every single detail of the DNA base. For example, GCCTAGCGAAGTCCAGCCTTACCG is the sequence while GCC——AGT———CCG denotes the DNA map involving three landmarks GCC, AGT and CCG. So, genome map creation for any human takes lesser time than sequence creation due to its lesser information and complexity.

Why is a genome map created?

Genome sequence is just a string of letters A, T, C, and G in a random fashion. To create a pattern and to differentiate each set from the other in a sequence, the genome map is created. Landmarks help in this differentiation which is of great aid to the scientists in segregating the necessary information from the redundant in the whole gene sequence. Gene map can also help sequencing in a certain way. If there are clones in the map that resemble each other, then they can be sequenced based on the pattern followed by that clone.

How is DNA mapping performed?

The first step involved in DNA mapping is to collect the samples of tissue from the person who needs to be tested. Then, the next step is isolating a gene and checking for its connections to a particular disease or disorder. This is done with the aid of DNA markers. These markers locate the gene which is infected. A collection of DNA markers on a genetic map shows that one among them reveals where the infected gene is present.

Benefits of DNA mapping:

Every human has a different structure of genetic arrangement. Each genetic structure denotes different data. Genes can convey a lot of information regarding a persons talents, skills, characteristics, sensitivity to certain foods, susceptibility to diseases and much more. Genetic tests involve the concept of DNA mapping to find the set of genes which are the reason behind occurrence of a disease and also set of genes that display a particular skill or ability. DNA mapping is used for various tests that would be of utmost benefit to any person by determining a lot of qualities. There are two genetic tests developed by Map my Gene namely Inborn Talent Genetic Test (ITGT) and Disease Susceptibility Gene Test (DSGT). ITGT is created for newborn kids whose hidden abilities and skills can be recognized at an early age itself. It would be of great advantage knowing what your children like and dislike in their childhood only. Besides this information, susceptibility to diseases can also be found by this test. If your child is prone to a disease due to inheritance, the reason due to it can be found and the disease can be cured too. ITGT can be of utmost benefit because it produces a complete list of around 46 traits including the ratings against each trait.

The other genetic test is DSGT which is primarily conducted to explore the diseases a person is highly susceptible to. Around 100 diseases can be detected by this test and in case if you are vulnerable to a particular disease, guidance in curing it is also provided by the medical experts of Map my Gene. The reason behind the vulnerability to a disease can also be known after taking this test. By knowing the potential risks of getting a disease well prior will highly reduce the chances of passing it on to your offspring. A healthy lifestyle can be maintained by people who take this test and can also save lots of money which needs be spent for curing it.

DNA mapping has a lot of benefits and few of them were listed here. Take a wise decision on choosing the best DNA testing method by referring to Map my Gene and stay healthy!

Many gifted children had to go through this test in hope to discover the secret in their DNA and gave them their intelligence.

Types of genetic testing

In this world of advanced medicine, genetic testing is still one of the best way to diagnose many diseases that usually take time to figure out in your body. In genetic testing or DNA testing, the genetic condition of your body is scruitinsed by taking blood samples and enables your doctor to identify the real reason and help you through any difficult time. The following are the different type genetic tests.

Diagnostic testing: In this, you undergo a test which will help the doctor identify the problem or disorder in your body, especially if you have physical symptoms such as Huntingtons disease in which your brain’s cells die out gradually. Through diagnostic testing, the doctor can track your health records since your birth, making it easier for him to plan your health care and also deal will the future ramifications of your disease. Interestingly, diagnostic testing can be done at any point in your life.

Prenatal testing: In this DNA testing, the doctor will be to identify any changes in your child’s genes before he is born. Since prenatal testing is done while you are pregnant, you can make a conscious and informed decision about your pregnancy once your doctor detects or rules out any disorder. In addition, if you are having a high risk pregnancy, then this testing will help you plan better as your due dates nears. Moreover, if there is disorder detected, then you will be able to prepare for your child’s birth by taking steps to ensure he becomes acquainted to the world in a better way.

Predictive testing: In this, you will undergo a test only if there is a family member who is suffering from a specific disease like cancer. For example, if your mother was diagnosed with cancer and but you have not shown any signs of it, then you can undergo predictive DNA testing. In predictive testing, the doctor will able to tell you if you would risk developing cancer in the near future. As a result of which, you will be consciously aware of your medical history and not take any medical problems lightly.

There is also process of Dna profiling is used to bring out which goes deep into the hereditary of the person. In presymptomatic testing, even before you start having those similar symptoms that your parent or your relative had. As a result of this, you will be able to avoid this disorder throughout your life with careful health plans.

Preimplantation testing: In this, a few cells from the womans embryo are taken and observed for genetic changes that could lead to disorders in the child. This testing can be done during in-vitro fertilisation, in which, the ovaries are fertilised with sperms through external processes. If there is a change in the embryos, those ovaries are discarded. Only the ones without any changes are implanted to enable pregnancy. Preimplantation allows the doctor to reduce the risk of any disorder.

Forensic testing: Identifying a body which is charred beyond recognition or is a John Doe is what DNA testing allows. In this the basic recognition of the person through the data base can help identify them if they are dead or victims of an attack. It is the fastest way to recognise them.

How Can Fillers Help In Reversing The Process Of Aging?

Your skin tends to lose fat and collagen when it ages. Some other factors that may have a damaging effect on your skin are pollution, poor diet, smoking and damage caused due to overexposure to the sun. All these factors may speed up the process of aging and make it appear saggy and wrinkly. Aging is not a simple process at all and happens due to both environmental and genetic factors. To some extent, it may occur due to your genes, over which you do not have much control. However, a significant cause of the aging process is due to what your body has to encounter for several years.

Irrespective of what could be the cause, aging leads to some changes in your skin due to your connective tissues’ loss and damage.

Elastin and collagen – molecular strands which provide elastic and tensile support for your skin – get deranged or reduced as you age, Healthy cells like fibroblasts and blood vessels slowly become less efficient or are lost as you age.

However, it is important to note that your skin does not age overnight since there are several actions that you can do to reverse or slow down the process.

One of the most efficient treatments to do this is through the use of dermal fillers in Singapore. When you get this treatment done by a good doctor, it can replenish and restore hyaluronic acid and collagen.

How dermal fillers work

These are non-surgical injections, which help in recovering your face’s youthfulness so that you retain a younger appearance. These injections are used for building up collagen, which disappears from your aging skin, thereby restoring the volume and lifting your sagging facial skin.

Some of the areas where dermal fillers can be applied are as follows.

  • Correction of hollowness around one’s eye area
  • Augment your jaw line
  • Building volume in nose, lips, chin, cheeks
  • Marionette lines
  • Smoker’s lines, which may appear above one’s upper lip
  • Frown lines
  • Laughter lines

Since a numbing cream is used during the treatment, dermal fillers are not quite painful and you may not feel uncomfortable during the treatment,

However, after going through this treatment, your skin will look younger for about 1 year to 18 months.

Fillers inducing collagen

Such fillers help to stimulate the body to build up and remodel your natural collagen. They constitute of fillers that last for a longer period of time and the impact persists for more than one year.

How important are Lutein supplements for older women?

Macular degeneration can lead to issues such as vision loss or cataracts. Aged women are especially susceptible to these issues and the visual impairment caused to them can turn out to be irreversible. It has been found that apart from aging, cigarette smoking can also lead to macular degeneration. Of course, free radicals can also wreck havoc on the body and cause this problem. It is therefore suggested that aged women should go for preventive measures in order to avoid these issues.

It is a proven fact that lutein can effectively help older women avoid the problems that may be caused due to macular degeneration. Apart from that, antioxidants in these supplements can help in maintaining eye health as well. To put it elaborately, the antioxidant properties of these supplements provide them with the ability to filter blue light and also in protecting the macula of the eyes from the oxidative damages caused by free radicals.

If older women are forced to work in places where they are constantly exposed to light, the retina of their eyes may be affected by oxidative metabolism. If they do not take the right steps to counter such oxidative damages, it may result in issues like vision loss or cataract. Extensive researches have been conducted and the findings of these researches have revealed that antioxidants can effectively treat these issues. This means if older women make it a point to consume lutein for eyes on a regular basis, they can prevent macular degeneration and lead a life free from worries.

Recent researches have also revealed that those women who consume adequate quantities of lutein are able to maintain good eye health. Though getting back their vision may be a tall order for older women, they can prevent the issues from affecting them by taking these supplements regularly.

A number of older women may have the wrong thinking that they had lived their life fully and completed their responsibilities and hence, there is no need for them to take care of their health. But in reality, as they keep aging rapidly, they must bestow all the more attention on their health because others should not think that they are burdensome. Not only that, if these older women do not take care of their health and more particularly, the health of their eyes, their dependence on others may increase.

On the contrary, if they take lutein regularly and take good care of their health and their eyesight, they can lead an independent and free life.

 

How is Hydrogen-Rich Water Made?

Thanks to decades of research, we have reached several advancements in various fields including health and medicine. Mankind has always sought ways to improve his health and prolong his lifespan. The constant understanding is that a healthy diet and lifestyle can certainly improve one’s health and add years to their life.

How can you achieve a healthy life?

Contrary to popular belief, a healthy life is not very hard to achieve. This will involve incorporating a very healthy diet that is rich in fruits, vegetables, pulses, nuts, grains, lean meats, etc. which will give your body all the nutrients it needs. Another step is to eliminate all unhealthy habits like smoking and excess consumption of alcohol. Exercising regularly also helps keep your body in excellent condition.

Following these steps can guarantee you a healthy, longer life. Along with including nutritious fruits and vegetables to your daily diet, you also have several other options that you should consider. One of these is a product called hydrogen-rich water. This product is manufactured and sold under several names such as Izumio Hydrogen Water that are easily available for purchase.

What is hydrogen water?

You have definitely heard of beverages that contain dissolved oxygen or carbon dioxide gases. Simply put, this product is normal water enriched with dissolved hydrogen gas. Years of research has led to the development of hydrogen-enriched water that has proven to have great benefits for human health.

Hydrogen is the most commonly found element in the universe, but its benefits to our health have only been recently discovered. Under normal conditions, hydrogen is available on our planet in the form of water, oil, gas, organic, and inorganic compounds. Thanks to advancement in the fields of science and medicine, scientists were able to safely and successfully develop hydrogen-rich water, which has proven to be very beneficial to our health. This product contains high amounts of antioxidants that keep our bodies safe from the harmful effects of free radicals. Hydrogen also plays a major role in the release of certain hormones and enzymes in our body.

How is hydrogen water made?

Water contains two atoms of hydrogen which are bound to an atom of oxygen. When hydrogen gas is passed through water, the free hydrogen atoms remain as they are as there are no free oxygen atoms for them to bind to. This process of hydrogenizing water is conducted using electrolysis ionizers. Another technique of creating hydrogen-rich water is by using pure magnesium, which helps break down water molecules to hydrogen and oxygen atoms.

Hydrogen-rich water is one of the safest products that can be consumed to help give you a much healthier life. Make sure you include products like Izumio Hydrogen Water to boost your health and lead a better life.

The Difference Between Dysport And Botox

Skin problems are a major issue because it is visible to others and creates a low image of oneself. It is one of the reasons why cosmetic procedures have gained such popularity in the last few years. From acne to wrinkles and even skin cancer, cosmetic procedures are helping individuals tackle a variety of skin problems.

Botox has been a popular cosmetic procedure for a long time now. Many people, including celebrities, still prefer Botox over other cosmetic procedures. One of the main reasons why Botox in Singapore is so popular is because it is one of the best minimally invasive procedures that actually work. It is also a product that has seen many changes and has been continuously improved to provide the best results possible.

In 2009, a new product similar to Botox was launched. The new product, called Dysport, is also FDA approved and uses the same botulinum toxin to reduce wrinkles.

Composition and action

Both Botox and Dysport are composed of botulinum toxin type A, which is used for muscle relaxation. Biologically and chemically, the two products are identical and contain the same 150 kilodalton active core. In terms of molecular size and weight of the accessory proteins, Dysport has greater variability than Botox.

The working action of both products is the same. They both help in relaxing muscles and removing wrinkles from the facial region.

Treating wrinkles

Although Botox and Dysport are made from slightly different variants of botulinum toxin, the protein works the same way for both. The toxin blocks nerve signals and therefore make the muscles unable to contract. Both treatment methods have gained approval form the FDA. Both products are equally effective on wrinkles and provide a clean and clear look.

Dosage difference

Dosage is probably the only area where the two differ. For the same treatment level, Dysport is used in larger quantities than Botox. Botox that is used in the same dosage level as Dysport are more effective in treating wrinkles. In this area, Botox scores higher than Dysport. Researchers have said that for cosmetic treatments, dosage is an important factor that determines efficiency of a product. Botox has been in the game for a long time and a lot of research has been conducted into perfecting the product. Dysport has been around for 7 years now and research is still ongoing for the product.