Uncategorized

Riveting facts about DNA Mapping

 

What is a genome map or DNA map?

A genome mapping or DNA mapping involves landmarks that usually are short sequences. DNA map and sequence are completely different. A map includes the series of landmarks while a sequence describes that DNA base in a clear fashion. In a nutshell, a genome map only shows the start, connecting and end landmarks that actually connect the sequence while a sequence shows every single detail of the DNA base. For example, GCCTAGCGAAGTCCAGCCTTACCG is the sequence while GCC——AGT———CCG denotes the DNA map involving three landmarks GCC, AGT and CCG. So, genome map creation for any human takes lesser time than sequence creation due to its lesser information and complexity.

Why is a genome map created?

Genome sequence is just a string of letters A, T, C, and G in a random fashion. To create a pattern and to differentiate each set from the other in a sequence, the genome map is created. Landmarks help in this differentiation which is of great aid to the scientists in segregating the necessary information from the redundant in the whole gene sequence. Gene map can also help sequencing in a certain way. If there are clones in the map that resemble each other, then they can be sequenced based on the pattern followed by that clone.

How is DNA mapping performed?

The first step involved in DNA mapping is to collect the samples of tissue from the person who needs to be tested. Then, the next step is isolating a gene and checking for its connections to a particular disease or disorder. This is done with the aid of DNA markers. These markers locate the gene which is infected. A collection of DNA markers on a genetic map shows that one among them reveals where the infected gene is present.

Benefits of DNA mapping:

Every human has a different structure of genetic arrangement. Each genetic structure denotes different data. Genes can convey a lot of information regarding a persons talents, skills, characteristics, sensitivity to certain foods, susceptibility to diseases and much more. Genetic tests involve the concept of DNA mapping to find the set of genes which are the reason behind occurrence of a disease and also set of genes that display a particular skill or ability. DNA mapping is used for various tests that would be of utmost benefit to any person by determining a lot of qualities. There are two genetic tests developed by Map my Gene namely Inborn Talent Genetic Test (ITGT) and Disease Susceptibility Gene Test (DSGT). ITGT is created for newborn kids whose hidden abilities and skills can be recognized at an early age itself. It would be of great advantage knowing what your children like and dislike in their childhood only. Besides this information, susceptibility to diseases can also be found by this test. If your child is prone to a disease due to inheritance, the reason due to it can be found and the disease can be cured too. ITGT can be of utmost benefit because it produces a complete list of around 46 traits including the ratings against each trait.

The other genetic test is DSGT which is primarily conducted to explore the diseases a person is highly susceptible to. Around 100 diseases can be detected by this test and in case if you are vulnerable to a particular disease, guidance in curing it is also provided by the medical experts of Map my Gene. The reason behind the vulnerability to a disease can also be known after taking this test. By knowing the potential risks of getting a disease well prior will highly reduce the chances of passing it on to your offspring. A healthy lifestyle can be maintained by people who take this test and can also save lots of money which needs be spent for curing it.

DNA mapping has a lot of benefits and few of them were listed here. Take a wise decision on choosing the best DNA testing method by referring to Map my Gene and stay healthy!

Many gifted children had to go through this test in hope to discover the secret in their DNA and gave them their intelligence.

Types of genetic testing

In this world of advanced medicine, genetic testing is still one of the best way to diagnose many diseases that usually take time to figure out in your body. In genetic testing or DNA testing, the genetic condition of your body is scruitinsed by taking blood samples and enables your doctor to identify the real reason and help you through any difficult time. The following are the different type genetic tests.

Diagnostic testing: In this, you undergo a test which will help the doctor identify the problem or disorder in your body, especially if you have physical symptoms such as Huntingtons disease in which your brain’s cells die out gradually. Through diagnostic testing, the doctor can track your health records since your birth, making it easier for him to plan your health care and also deal will the future ramifications of your disease. Interestingly, diagnostic testing can be done at any point in your life.

Prenatal testing: In this DNA testing, the doctor will be to identify any changes in your child’s genes before he is born. Since prenatal testing is done while you are pregnant, you can make a conscious and informed decision about your pregnancy once your doctor detects or rules out any disorder. In addition, if you are having a high risk pregnancy, then this testing will help you plan better as your due dates nears. Moreover, if there is disorder detected, then you will be able to prepare for your child’s birth by taking steps to ensure he becomes acquainted to the world in a better way.

Predictive testing: In this, you will undergo a test only if there is a family member who is suffering from a specific disease like cancer. For example, if your mother was diagnosed with cancer and but you have not shown any signs of it, then you can undergo predictive DNA testing. In predictive testing, the doctor will able to tell you if you would risk developing cancer in the near future. As a result of which, you will be consciously aware of your medical history and not take any medical problems lightly.

There is also process of Dna profiling is used to bring out which goes deep into the hereditary of the person. In presymptomatic testing, even before you start having those similar symptoms that your parent or your relative had. As a result of this, you will be able to avoid this disorder throughout your life with careful health plans.

Preimplantation testing: In this, a few cells from the womans embryo are taken and observed for genetic changes that could lead to disorders in the child. This testing can be done during in-vitro fertilisation, in which, the ovaries are fertilised with sperms through external processes. If there is a change in the embryos, those ovaries are discarded. Only the ones without any changes are implanted to enable pregnancy. Preimplantation allows the doctor to reduce the risk of any disorder.

Forensic testing: Identifying a body which is charred beyond recognition or is a John Doe is what DNA testing allows. In this the basic recognition of the person through the data base can help identify them if they are dead or victims of an attack. It is the fastest way to recognise them.