Uncategorized

Important things you need to consider before buying a commercial automobile insurance

Important things you need to consider before buying a commercial automobile insurance

The number of tucks or vehicle you own should not determine if you should get a commercial automobile insurance. Whether you run a big business that has a garage full of tucks or you operate a small business at the comfort of your home, it is important that you get commercial vehicle insurance.

Every business owner who uses a car, van or a pick-up truck should consider getting commercial vehicle insurance.

Business owners who fail to insure their vehicles often regret it especially when they are involved in an accident. On the other hand business owners who insure their commercial vehicles receive a compensation that will help him cover the cost of repair in the event of an accident.

Risks are constant in any business. Before insuring any vehicle you use for your business, you have to be knowledgeable about certain requirement and expectations, so as to avoid any form of complication in the future.

If you find yourself needing commercial vehicle insurance, do consider Allegiance Vehicle Insurance Singapore. They cover a wide range of insurance not only for vehicle, but for personal and corporate. You should check out their site today.

The following article by cholainsurance shed light on some important things you need to consider when buying commercial vehicle insurance.

Things to consider when buying commercial vehicle insurance

If you own a commercial vehicle, but not a vehicle insurance policy, you have the following facts to consider. According to an article published in March 2013 by Bimabazaar.com, an online insurance knowledge portal from the Insurance Times monthly journal publishers, the number of vehicles on Indian roads has already crossed the 55 million mark. The number of vehicles hit the roads increased by 170 times between 1951 and 2000, while the length of the existing road network has expanded only by 9 times, leading to serious traffic congestion, pollution and frequent road accidents in the country. Read more here.

You likely now know a handful of things to consider when buying commercial vehicle insurance. Making the decision to insure your commercial vehicles is by no means a walk in the park. You likely may wonder if insuring your vehicles is really necessary or how you are going to benefit from it. Know how commercial vehicle insurance can protect your business and prevent you from spending a lot of money in the event of an accident will motivate you to get it.

The following article by Erick Barnes shed light on some seven reasons why you should consider buying commercial vehicle insurance.

Top 7 reasons to by commercial vehicle insurance

Whether you run a business that has a garage full of semi-trucks or you operate a business out of your home, it is important for all businesses to have a commercial vehicle or commercial truck insurance. Many freelancers or small business owners wonder what commercial vehicle insurance is and mistakenly believe that it is a code word for “semi truck insurance,” but that’s not the case.  Read more here.

You probably now know some reasons why you should consider buying commercial vehicle insurance. Just before you insure your commercial vehicles, it is important that you know the differences between commercial and personal vehicle insurance. Knowing the differences between them will help you determine the one that will suit your needs. It is also going to prevent you from making regrettable mistakes like -getting personal auto insurance for the vehicles you use to run your business.

The following article by thehartford discusses the differences between commercial and personal auto insurance.

Differences between commercial and personal auto insurance

Commercial auto and personal auto insurance have a lot of similarities in terms of the fundamental types of protections they offer. But one of the key differences with a commercial policy is that it gives you the ability to protect yourself and your business from exposure to uncovered liabilities that result from a serious accident. Read more here.

You surely now know that there are some differences between commercial and personal auto insurance. Of course, they are similar in some area, but their policies are somewhat different. The nature of your business is often going to determine the one that will suit your needs. For example, if work at home and rarely run business errands personal auto insurance will be right for you. On the other hand, if you run a lot of business errands then commercial auto insurance will be perfect for you.

Final note

As a business owner, you should make it your aim to insure the vehicles you use to run your business. Making the decision to buy commercial vehicle insurance may be difficult for you. Well, if that is the case, you should create time to consider some important facts about the rate of accident and the number of vehicles in your region.

Insuring the vehicles you use for your business is a smart move. If any of your vehicles happen to be involved in an accident, you will be compensated.

Just before you buy commercial vehicle insurance, you have to know a thing or two about the differences between personal and commercial vehicle insurance.

What Are the General Insurance Plans Small Businesses Should Buy?

If you are the owner of a small business, you may wonder which insurance plans you should buy for conducting your business smoothly. Though general insurance companies offer a good number of plans, it is not necessary that you should buy all of them. But there are certain policies you should necessarily buy in order to run your company with peace of mind. Let us find out the plans you should buy.

If you are looking for commercial vehicle insurance at a good price, do consider Vehicle Insurance Allegiance price for Insurance. They cover a wide range of insurance not only for vehicle, but for personal and corporate. You should check out their site today.

1. Liability Insurance

Almost all the companies, regardless of their size, should buy this insurance because it offers protection from the cost of handling the claims of those who are said to have been affected by the services or products you are offering. In addition, this policy will cover the damages to properties as well as the bodily injuries that may have been caused to these third parties as well.

2. Property Insurance

If your company owns a building, you must get it insured against risks such as smoke, fire, theft, or vandalism, You must get other items like office equipment, tools, inventory, computers, etc. insured also against these risks. These risks can cause interruption to the conduct of your business and so, you can add a clause that protects against losses that you may suffer due to such interruptions.

3. BOP

BOP is otherwise known as Business Owner’s Policy. This policy provides a wide cover that includes protection against losses due to business interruption. Property insurance, car or vehicle insurance, crime insurance, and liability insurance are also covered under this policy. If you are a business owner with a frugal mindset, you can benefit immensely by opting for BOP because you will get a wider cover at a reasonable cost.

4. Commercial Vehicle Insurance

Since there will be one or more cars or other types of vehicles owned by your company, you should buy Commercial Vehicle Insurance as well. This insurance will protect your company from losses that may be caused due to collisions or damages. If your company does not own any vehicle and if your employees commute to the workplace by their own cars or do official work by using their cars, you must buy what is called “non-owned auto liability insurance plan” for protecting your company against risks.

5. Worker’s Compensation

This policy insures your employees against risks like injuries they may sustain when they are doing their official work. This will provide them with wage replacement as well as medical benefits to those who are injured while carrying out the official tasks that have been entrusted to them.

In addition to the above, you must buy other insurance policies that include Professional Liability Insurance, that is also called Errors and Omissions Insurance, Data Breach insurance, etc. as well for protecting your entity from various types of risks that you may encounter along your entrepreneurial journey.

What Goes Into Optimizing Smart City Solutions

What Goes Into Optimizing Smart City Solutions?

Although most people do not realise it, extended periods of poor planning has made some cities lose all hope for further growth. It is imperative that all urban amenities are optimised right from the start, if it is to have any hope of being tuned up in the future. For a city to experience reasonable economic growth and evolution, its amenities need to be carefully planned and implemented. The same logic extends to smart city solutions as well. Fortunately, policy makers are not repeating the mistakes the earlier town planners did and are trying to optimise the smart city solutions to the maximum extent possible. In this article we shall discuss, what goes into optimising smart city solutions.

If you are looking for
For the smart city solutions to be optimised to the maximum extent possible, it is important to have all pertinent data required to do so. Working with inaccurate data or estimates will cause more harm than good in the long run. This is especially true of infrastructure based solutions, as consolidated data sets are the basis of firm decisions making in infrastructural issues. Fortunately, this process is a lot easier now, thanks to technology. It is high time city planners started leveraging Geographic Information Systems (GIS) for the good it can do in city planning and administration.

Forecasting impending changes
Thanks to globalisation, the world is a lot more dynamic now than it was before. In these days of rapid changes and progressions, predictive analytics are the need of the hour. Smart city solutions must be optimised to predict major changes, so that the local governments can be prepared for any unforeseen events that maybe around the corner. Several cities around the world are already doing this to protect cities from natural calamities like floods. Smart city solutions must be continuously updated if it is to stay relevant in the future and for this to happen smoothly, the changes need to be predicted as early as possible. Major changes to any infrastructural component requires preparation and time for implementation, so incorporating predictive measures is extremely important to minimise downtimes.

Automated solving of issues
Once the analytics part and predictive mechanisms are successfully implemented, the only part of optimisation left is strategic combining of them. With the help of advance technology of today, it is possible to easily implement a self diagnosing and repairing system for minor issues. As technology progresses, it will eventually become possible to incorporate automated troubleshooting into smart city solutions. Such a system will require no human intervention for administration greatly reducing the overhead involved in managing smart city solutions.

Benefits of commercial vehicle insurance

Benefits of commercial vehicle insurance

If you need to drive around from time to time or you have a fleet of business vehicles and drivers, you should consider buying commercial vehicle insurance. As a business owner, this is likely going to be a big decision for you. Insuring the vehicles you use to run your business is a wise decision.

The truth is that there are a lot of benefits commercial vehicle insurance can offer you. In the event of an accident, you and your employee will be covered. Your vehicle and the vehicle of others that may be involved will be covered as well.

Commercial auto insurance doesn’t just protect your car. It protects your business as well. If you happen to be involved in a serious accident and others are hurt, the insurance company will shoulder the damage.

If you find yourself needing commercial Vehicle Insurance Singapore, do consider Allegiance Associates. They cover a wide range of insurance not only for vehicle, but for personal and corporate. You should check out their site today.

The following article by agentinsure shed light on the benefits of commercial auto insurance.

What are the benefits of commercial auto insurance?

There are a number of important benefits that commercial auto insurance can offer you, with one of the most important beings that your business can stay compliant with the local and state laws by having this type of policy. The law requires that everyone maintains at least the state minimum auto insurance coverage for any vehicle you drive. Read more here.

You likely now know some of the benefits of commercial auto insurance. These benefits are probably going to motivate you to insure the vehicles you use to run your business. One amazing thing about commercial auto insurance is that it covers both you and your employees. Also, if you happen to be involved in an accident when using your personal car to carry out business activities, you will be covered. Knowing the right time to get commercial auto insurance is also very important.

The following article by Geico Gecko will help you determine when you need commercial auto insurance.

Knowing when you need commercial auto insurance

Understanding why you need auto insurance on your personal vehicle is easy.  You want to protect your loved ones and your property and also it is required by law in most states.  Knowing when you need commercial insurance is a completely different matter.  There are certain types of vehicle usage that are not covered under a personal auto policy. Read more here

You probably know the right time to get commercial auto insurance. You definitely will agree that insuring your personal vehicle is important. Since you want to protect your loved ones and property, you will not contemplate getting personal auto insurance. On the other, knowing when to get commercial vehicle insurance is somewhat tricky. If you own a vehicle you use solely to carry out business activities then you should consider getting commercial auto insurance. It is also important that you create time to learn the differences between commercial and personal auto insurance.

The following article by Auto Insurance shed light on the differences between commercial and personal auto insurance.

What’s the difference between commercial and personal auto insurance?

When you hear the term, “commercial auto insurance,” you may think that it refers to a type of insurance that only applies to people who do business with their vehicles, like taxicab drivers, tow truck drivers, or pizza delivery drivers. While these people could benefit from commercial auto insurance, so could many others–even your Aunt Wanda who makes a living baking and delivering her famous homemade donuts! If she could use a commercial auto policy, could you? Read more here

You like now know the differences between commercial and personal auto insurance. You also now know that you don’t need to be the owner of a truck company or a delivery business before getting commercial vehicle insurance. Even if you work in the comfort of your home, you are still going to benefit a lot from commercial auto insurance. 

Final note

 If you happen to be involved in an accident and you don’t have commercial auto insurance, you are going to be in serious trouble. If the affected party filed a lawsuit and the judge award damages that could swallow up all the profit from your company, your business may crumble. But all these can be avoided. Commercial auto insurance is going to protect you and your business in the event of an accident. 

The fact that you run a small business doesn’t mean that you don’t need commercial auto insurance. If you run some business errands from time to time, then you should consider getting commercial auto insurance. If you don’t, you are likely going to regret your decision in the future.

Finally, learning the differences between commercial and personal auto insurance will aid you in choosing the one that will suit your needs.

What Are The Safety Upgrades One Can Do In Summer


What Are The Safety Upgrades One Can Do In Summer?

People have always looked forward to summer months, as they can enjoy basking in the sun without any restrictions. Summer is the only season during which, outdoor events can be hosted without worries. With so many things going for people during the summer months, it is potentially a good time to upgrade one�s security situation. While intrusion detection systems can be upgraded throughout the year, DIY security upgrades are best done during the summer months. Surprisingly, this concept of summer security reboot is fairly old, as most people service and check their home security peripherals during the summer months itself. In this article we shall discuss what are the safety upgrades one can do in summer.

If you are looking for an intrusion detection system, do consider ATT Systems Group . They have a wide expertise in many security systems and have the know-how to solve your queries and problems. You can check out their site here: http://www.attsystemsgroup.com/intrusion-detection-system

Servicing smoke detectors
Most people mistakenly assume that their smoke detectors need no servicing from time to time, nothing can be more farther from the truth. A properly functioning smoke detector can mean the difference between life and death in fire accident. It is imperative that the smoke detectors batteries are checked periodically. Merely buying a fancy smoke detector and not maintaining it can prove to be costly, if one is not too careful. The chances of carbon monoxide poisoning becomes significantly high during fire accidents, people are better off buying smoke detectors
which can detect the presence of carbon monoxide in air.

General up gradation around the house
As summer months are often accompanied by stifling heat, electricity consumption goes off charts in most houses. Hence people should try to upgrade their home appliances from time to time, in order to make use of the latest energy saving technologies available in the market. Using smart home automation systems is strongly recommended, as it benefits people in many ways. People will be able to remotely operate their home appliances and thus minimize unwanted energy wastage. Energy usage patterns provided by smart home systems, can help people better manage their electricity bills. While most people prefer to put off upgrading things as late as possible, doing it periodically does have some unique benefits.

Cleaning and maintenance of summer appliances
Most people prefer to host barbeques on the outside during summer months, in order to avoid heating up the house. Since people do not use barbeques regularly, they can easily get malfunctioned. This should be avoided at all costs. Periodically maintaining summer appliances like barbeques will save people both time and money in the long run.

Studying and Understanding Economics

Economics is one of the disciplines being studied in school and there are a lot of reasons why we, as citizens and humans, should be able to know and understand economics. Economics runs a lot of things in this world and we should be aware of that. In this article, we are going to help you with that as we will tell you more about the importance of learning about and understanding economics.

If you are looking for a good Econs tuition Singapore for A’ Levels, you can try Advo Education Centre that offers quality Economics tuition. They feature ex-MOE teachers and have a wealth of prior teaching experience. If you need help for Economics urgently, they also have topic-focused intensive courses to help you improve quickly and effectively. If you are serious about improving your grades, you should check out their site immediately.

To start, William Walstad will tell us why it is important for us to understand economics.

Why it’s Important to Understand Economics

The case for economic literacy is a strong one. George Stigler, a Nobel Laureate in economics, probably stated it best almost three decades ago when he wrote: “The public has chosen to speak and vote on economic problems, so the only open question is how intelligently it speaks and votes.” In Stigler’s view, economic literacy is special because it contributes to two classes of knowledge. First, it serves as a “means of communication among people, incorporating a basic vocabulary or logic that is so frequently encountered that the knowledge should be possessed by everyone.” Second, it is a “type of knowledge frequently needed and yet not susceptible to economical purchase from experts.”

Economic literacy certainly contributes to the first class of knowledge. People like to think and talk about the economic issues that affect them as consumers, workers, producers, investors, citizens and in other roles they assume over a lifetime. Economic literacy also gives people the tools for understanding their economic world and how to interpret events that will either directly or indirectly affect them. Read more here.

The importance of economic literacy is really well explained above. According to William Walstad, economic literacy gives people the tools for understanding their economic world and how to interpret events that will either directly or indirectly affect them. Now, the University of Illinois at Chicago will tell us why we should study economics as an undergraduate.

WHY STUDY ECONOMICS AS AN UNDERGRADUATE?

Economics is the study of how societies, governments, businesses, households, and individuals allocate their scarce resources. Our discipline has two important features. First, we develop conceptual models of behavior to predict responses to changes in policy and market conditions. Second, we use rigorous statistical analysis to investigate these changes.

Economists are well known for advising the president and congress on economic issues, formulating policies at the Federal Reserve Bank, and analyzing economic conditions for investment banks, brokerage houses, real estate companies, and other private sector businesses. They also contribute to the development of many other public policies including health care, welfare, and school reform and efforts to reduce inequality, pollution and crime.

The study of economics can also provide valuable knowledge for making decisions in everyday life. It offers a tool with which to approach questions about the desirability of a particular financial investment opportunity, whether or not to attend college or graduate school, the benefits and costs of alternative careers, and the likely impacts of public policies including universal health care and a higher minimum wage.Read more here.

According to what was mentioned above, economics major prepares students for careers in banking, insurance, service and manufacturing firms, real estate, consulting, government agencies, and non-profit organizations. If you want to be part of them, then you should really probably study economics. However, there are also ways we could learn about economics without going back to school. Mike Bird will tell us about it.

Three ways you can learn about economics without going back to school

It’s a familiar situation for lots of people, especially since the financial crisis— Perhaps you’ve gone to university, or perhaps you haven’t, but you want to know more about economics.

It seems not only like an important subject, but one that leaks into lots of parts of everyday life — as well as politics, technology, business, and pretty much everything really.

The good news is that there are plenty of ways to pick up a self-made education in economics, even if you don’t want to learn the maths or go back to school.

Here are just three of the ways you can get into the dismal science.

Lectures on YouTube

MIT’s Principles of Microeconomics course is chopped into 26 videos of between 45 and 50 minutes, and it’s all available on YouTube. Though you’re deprived of the ability to ask questions, what you do get is the ability to rewind. It’s not a bad swap. Read more here.

The three ways we could learn economics without going back to school are through YouTube lectures, massive open online courses or MOOCs, and self-study with books. If you really want to study economics, you can do it at home through the ways provided above. Studying economics could really do us something good in many aspects of life that is why we have to take the opportunity if we have it.

Why Vehicle Counters Are Indispensable Right Now?

The vast majority of people are unaware of the benefits that cities enjoy by employing vehicle counters at strategic locations in towns. Traffic counters are not just meant to analyse vehicular traffic like many people think, it provides valuable insights for the town planners when they want to improve the transportation infrastructure. Numerous cities and town have vastly benefitted from the data collected through traffic counters running round the clock.

If you are a city planner or a traffic company and are looking for a traffic counter, you should consider ATT Systems Traffic Counter System. This system tracks both vehicles and human traffic, provides real-time statistics, and can be portable or fixed. If you are looking for such a solution, you should check out ATT Systems site above.

In this article, we shall discuss why vehicle counters are indispensable right now.

To keep the tolls booths in top shape
Almost everyone would have passed through toll booths at least for a few times in their life. For many people, passing through toll booths is an everyday affair, unlike a few people who go through them only during long drives to distant places. Considering the amount of traffic toll booths cater to each day, it is imperative that they are adequately staffed and have the infrastructure to facilitate uninterrupted flow of traffic. Traffic counters help the government immensely in this regard. By employing traffic counters, governments can gain a clear understanding of the times of day or days in the year, when the toll booths experience a huge influx of vehicles. This way government can schedule maintenance of the roads and highways that the toll booths serve, such that people experience the least amount of inconvenience. Additionally, with the information of the kind of traffic the roads or highways experience, governments will be in a better position to predict the need for the next maintenance.

For car washes to function profitably
The weather plays an important role in the frequency with which people bring their cars to be cleaned in the car washes. It has been observed by experts that, people living in the tropical regions of the world where it is mostly sunny throughout the year, like to keep their cars clean as a whistle and hence visit the car washes more often. While people living in the temperate or colder regions of the world, often have to get rid of the salt deposits on the surface of their cars brought about by the snow, to keep corrosion at bay. And hence people in these colder regions visit car washes more frequently during the snowy months than the warmer months. Car washes can rely on traffic counters to assess the times in the year when they are more likely to have a greater number of customers. This knowledge will help them schedule the maintenance works of the car wash during the times when they are less likely to be busy. Also, they can temporarily increase the staff on hand, during the busier periods to minimise the wait times for the customers.

Riveting facts about DNA Mapping

 

What is a genome map or DNA map?

A genome mapping or DNA mapping involves landmarks that usually are short sequences. DNA map and sequence are completely different. A map includes the series of landmarks while a sequence describes that DNA base in a clear fashion. In a nutshell, a genome map only shows the start, connecting and end landmarks that actually connect the sequence while a sequence shows every single detail of the DNA base. For example, GCCTAGCGAAGTCCAGCCTTACCG is the sequence while GCC——AGT———CCG denotes the DNA map involving three landmarks GCC, AGT and CCG. So, genome map creation for any human takes lesser time than sequence creation due to its lesser information and complexity.

Why is a genome map created?

Genome sequence is just a string of letters A, T, C, and G in a random fashion. To create a pattern and to differentiate each set from the other in a sequence, the genome map is created. Landmarks help in this differentiation which is of great aid to the scientists in segregating the necessary information from the redundant in the whole gene sequence. Gene map can also help sequencing in a certain way. If there are clones in the map that resemble each other, then they can be sequenced based on the pattern followed by that clone.

How is DNA mapping performed?

The first step involved in DNA mapping is to collect the samples of tissue from the person who needs to be tested. Then, the next step is isolating a gene and checking for its connections to a particular disease or disorder. This is done with the aid of DNA markers. These markers locate the gene which is infected. A collection of DNA markers on a genetic map shows that one among them reveals where the infected gene is present.

Benefits of DNA mapping:

Every human has a different structure of genetic arrangement. Each genetic structure denotes different data. Genes can convey a lot of information regarding a persons talents, skills, characteristics, sensitivity to certain foods, susceptibility to diseases and much more. Genetic tests involve the concept of DNA mapping to find the set of genes which are the reason behind occurrence of a disease and also set of genes that display a particular skill or ability. DNA mapping is used for various tests that would be of utmost benefit to any person by determining a lot of qualities. There are two genetic tests developed by Map my Gene namely Inborn Talent Genetic Test (ITGT) and Disease Susceptibility Gene Test (DSGT). ITGT is created for newborn kids whose hidden abilities and skills can be recognized at an early age itself. It would be of great advantage knowing what your children like and dislike in their childhood only. Besides this information, susceptibility to diseases can also be found by this test. If your child is prone to a disease due to inheritance, the reason due to it can be found and the disease can be cured too. ITGT can be of utmost benefit because it produces a complete list of around 46 traits including the ratings against each trait.

The other genetic test is DSGT which is primarily conducted to explore the diseases a person is highly susceptible to. Around 100 diseases can be detected by this test and in case if you are vulnerable to a particular disease, guidance in curing it is also provided by the medical experts of Map my Gene. The reason behind the vulnerability to a disease can also be known after taking this test. By knowing the potential risks of getting a disease well prior will highly reduce the chances of passing it on to your offspring. A healthy lifestyle can be maintained by people who take this test and can also save lots of money which needs be spent for curing it.

DNA mapping has a lot of benefits and few of them were listed here. Take a wise decision on choosing the best DNA testing method by referring to Map my Gene and stay healthy!

Many gifted children had to go through this test in hope to discover the secret in their DNA and gave them their intelligence.

Types of genetic testing

In this world of advanced medicine, genetic testing is still one of the best way to diagnose many diseases that usually take time to figure out in your body. In genetic testing or DNA testing, the genetic condition of your body is scruitinsed by taking blood samples and enables your doctor to identify the real reason and help you through any difficult time. The following are the different type genetic tests.

Diagnostic testing: In this, you undergo a test which will help the doctor identify the problem or disorder in your body, especially if you have physical symptoms such as Huntingtons disease in which your brain’s cells die out gradually. Through diagnostic testing, the doctor can track your health records since your birth, making it easier for him to plan your health care and also deal will the future ramifications of your disease. Interestingly, diagnostic testing can be done at any point in your life.

Prenatal testing: In this DNA testing, the doctor will be to identify any changes in your child’s genes before he is born. Since prenatal testing is done while you are pregnant, you can make a conscious and informed decision about your pregnancy once your doctor detects or rules out any disorder. In addition, if you are having a high risk pregnancy, then this testing will help you plan better as your due dates nears. Moreover, if there is disorder detected, then you will be able to prepare for your child’s birth by taking steps to ensure he becomes acquainted to the world in a better way.

Predictive testing: In this, you will undergo a test only if there is a family member who is suffering from a specific disease like cancer. For example, if your mother was diagnosed with cancer and but you have not shown any signs of it, then you can undergo predictive DNA testing. In predictive testing, the doctor will able to tell you if you would risk developing cancer in the near future. As a result of which, you will be consciously aware of your medical history and not take any medical problems lightly.

There is also process of Dna profiling is used to bring out which goes deep into the hereditary of the person. In presymptomatic testing, even before you start having those similar symptoms that your parent or your relative had. As a result of this, you will be able to avoid this disorder throughout your life with careful health plans.

Preimplantation testing: In this, a few cells from the womans embryo are taken and observed for genetic changes that could lead to disorders in the child. This testing can be done during in-vitro fertilisation, in which, the ovaries are fertilised with sperms through external processes. If there is a change in the embryos, those ovaries are discarded. Only the ones without any changes are implanted to enable pregnancy. Preimplantation allows the doctor to reduce the risk of any disorder.

Forensic testing: Identifying a body which is charred beyond recognition or is a John Doe is what DNA testing allows. In this the basic recognition of the person through the data base can help identify them if they are dead or victims of an attack. It is the fastest way to recognise them.